View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20754_low_3 (Length: 545)
Name: NF20754_low_3
Description: NF20754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20754_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 173 - 540
Target Start/End: Original strand, 40464099 - 40464470
Alignment:
| Q |
173 |
ggttatatttttagtctataatagaccatcaaaatttaccaacacatatatgaccaataatatttattagtatctcttatatactaaatcatagtagtga |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||| |
|
|
| T |
40464099 |
ggttatatttttagtctataatagaccatcaaaatttaccaaaacatatatgaccaataatatttactagtatctcttatatactacatcgtagtagtga |
40464198 |
T |
|
| Q |
273 |
ttcactaagttttgaaatgattcacaagtttaatagtggattcagcacccttacatttatagatatacacctagttcacgcggttagaatatcagtgccc |
372 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40464199 |
ttcactaatttttggaatgattcacaagtttaatagtggattcagcacccttacatttatagagatacccctagttcacgcggttagaatatcagtgccc |
40464298 |
T |
|
| Q |
373 |
atttaatcaaatattagaaggtctaaattaaaatttacattttatgaattgtctaattttgattaaatgactaccaatgttgttacaactgcatg----a |
468 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||| | |
|
|
| T |
40464299 |
atttaatcaaatattagaaggtctaaattaaaatttacattttatgaattgtctaattttgattaaacgactgccaatgttgtcacaactgcatgaatta |
40464398 |
T |
|
| Q |
469 |
atgcggaatcctctaacttcataaatccaaattcgtctatagtcatgcggtttgatcagagactcgctagtt |
540 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
40464399 |
atgcgggatcctctaacttctcaaatccaaattcgtctataatcatgcggtttgatcaaagactcgctagtt |
40464470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University