View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20756_high_26 (Length: 234)
Name: NF20756_high_26
Description: NF20756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20756_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 25165708 - 25165607
Alignment:
| Q |
18 |
aaacaaagcaaattattaacatgccaaacaaaatgtttgactgagctgtgtgaactagaacactcatataatttatttttaccaaacacacccttaaagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
25165708 |
aaacaaagcaaattattaacatgccaaacaaaatgtttgactgagc--tgtgaactagaacactcttatagtttatttttaccaaacacacacttaaagt |
25165611 |
T |
|
| Q |
118 |
aatg |
121 |
Q |
| |
|
|||| |
|
|
| T |
25165610 |
aatg |
25165607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University