View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20756_high_9 (Length: 444)
Name: NF20756_high_9
Description: NF20756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20756_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 15 - 437
Target Start/End: Complemental strand, 21829904 - 21829482
Alignment:
| Q |
15 |
aaataaaactcaagggaagaataaatgggttaaggttaggcaaagtgggaaatcacaaaaagagctttcagctttgcatttatgtcaagaatttcaagca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21829904 |
aaataaaactcaagggaagaataaatgggttaaggttaggcaaagtgggaaatcacaaaaagagctttcagctttgcatttatgtcaagaatttcaagca |
21829805 |
T |
|
| Q |
115 |
catgaagggtgtatttggactatgaagtttagtttggatggaaggtttttggctactgctggtgaggataaagtgatacatatttgggaagttcaagaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21829804 |
catgaagggtgtatttggactatgaagtttagtttggatggaaggtttttggctactgctggtgaggataaagtgatacatatttgggaagttcaagaat |
21829705 |
T |
|
| Q |
215 |
gtgaggttatgagtatgagaggtgaggaagggaatcttactcctattcatccttctttgctttcttctatggaaagagnnnnnnntgttgatactcatag |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
21829704 |
gtgaggttatgagtatgagaggtgaggaagggaatcttactcctattcatccttctttgctttcttcaatggaaagagaaaaaaatgttgatactcatag |
21829605 |
T |
|
| Q |
315 |
tttggttaagaagaaagggaaatttggaagtaaaagaggaggagggtcagcagctattcctgaatatgttcatgtgcctgaaaatgtttttactttctct |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21829604 |
tttggttaagaagaaagggaaatttggaagtaaaagaggaggagggtcagcagctattcctgaatatgttcatgtgcctgaaaatgtttttactttctct |
21829505 |
T |
|
| Q |
415 |
gagaaaccttattgttcatttca |
437 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
21829504 |
gagaaaccttattgttcttttca |
21829482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University