View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20756_low_11 (Length: 423)
Name: NF20756_low_11
Description: NF20756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20756_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 14 - 407
Target Start/End: Complemental strand, 36998950 - 36998557
Alignment:
| Q |
14 |
gagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggcagcacgtgaacacaatgcggcggtcaaacagacgaccactg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998950 |
gagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggcagcacgtgaacacaatgcggcggtcaaacagacgaccactg |
36998851 |
T |
|
| Q |
114 |
ctgcggctgggcatatgggtcagccccaccacaccccagggacgactggaacggggaccgccacatactctaccactgggaattatggacatcccactgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998850 |
ctgcggctgggcatatgggtcagccccaccacaccacagggacgactggaacggggaccgccacatactctaccactgggaattatggacatcccactgg |
36998751 |
T |
|
| Q |
214 |
ggcacatcagatgtcagccatgcctggtcatggaactggacagcccacgggccatgtcgtcgacggtgtggtgggctcacaccctattgggactaataga |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998750 |
ggcacatcagatgtcagccatgcctggtcatggaactggacagcccacgggccatgtcgtcgacggtgtggtgggctcacaccctattgggactaataga |
36998651 |
T |
|
| Q |
314 |
ggcacagatgggaccgccacggcccataatacccgtgttggtggaaatccaaatgccacagggtataccactggtggtacttataaatgaatac |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36998650 |
ggcacagatgggaccgccacggcccataatacccgtgttggtggaaatccaaatgccacagggtacaccactggtggtacttataaatgaatac |
36998557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University