View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20756_low_15 (Length: 342)

Name: NF20756_low_15
Description: NF20756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20756_low_15
NF20756_low_15
[»] chr4 (5 HSPs)
chr4 (19-330)||(5920970-5921279)
chr4 (19-200)||(5934558-5934739)
chr4 (19-172)||(5532754-5532907)
chr4 (30-166)||(38176916-38177052)
chr4 (244-324)||(5934412-5934494)
[»] chr8 (2 HSPs)
chr8 (26-140)||(40916226-40916340)
chr8 (36-127)||(45320547-45320638)
[»] chr2 (1 HSPs)
chr2 (30-112)||(11731826-11731908)
[»] chr7 (1 HSPs)
chr7 (25-145)||(34841829-34841949)
[»] chr1 (1 HSPs)
chr1 (27-178)||(45452322-45452473)
[»] chr3 (1 HSPs)
chr3 (30-103)||(53145991-53146064)


Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 19 - 330
Target Start/End: Complemental strand, 5921279 - 5920970
Alignment:
19 tgttcgggagaaaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcgga 118  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
5921279 tgttcaggagaaaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtctga 5921180  T
119 atatcaacagtatcaagatgctactgcagaggaggatgagtatgaagatgaagaggaggattatcagcaggaacatgatgagatgtgagcatgttgatgc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5921179 atatcaacagtatcaagatgctactgcagaggaggatgagtatgaagatgaagaggaggattatcagcaggaacatgatgagatgtgagcatgttgatgc 5921080  T
219 tttttgcaatggataacacatatctgcaacttcctgttgccggttcgtaatctctgttgtaaggggatacttttgttccggctgttatgaaattgtttct 318  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
5921079 tttttgcaatggataacac--atctgcaacttcctgttgccggttcgtaatctctgttgtaagggaatacttttgttccggctgttatgaaattgtttct 5920982  T
319 ggttttcatttc 330  Q
    ||||||||||||    
5920981 ggttttcatttc 5920970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 5934739 - 5934558
Alignment:
19 tgttcgggagaaaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcgga 118  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
5934739 tgttcaggagaaaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcaga 5934640  T
119 atatcaacagtatcaagatgctactgcagaggaggatgagtatgaagatgaagaggaggattatcagcaggaacatgatgag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5934639 atatcaacagtatcaagatgctactgcagaggaggatgagtatgaagatgaagaggaggattatcagcaggaacatgatgag 5934558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 19 - 172
Target Start/End: Original strand, 5532754 - 5532907
Alignment:
19 tgttcgggagaaaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcgga 118  Q
    ||||| |||||||||||||||||||||||||||| |||||||| ||||| || ||||| |||||||||||||||||||||||||||||||| ||  | ||    
5532754 tgttcaggagaaaggctttcttgcattggtacactggtgaaggcatggacgaaatggaattcactgaggctgagagcaacatgaatgatctggttgctga 5532853  T
119 atatcaacagtatcaagatgctactgcagaggaggatgagtatgaagatgaaga 172  Q
     ||||||||||| |||||||| || || || ||||||||||||| ||| |||||    
5532854 gtatcaacagtaccaagatgccaccgctgatgaggatgagtatggagaagaaga 5532907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 166
Target Start/End: Complemental strand, 38177052 - 38176916
Alignment:
30 aaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaacagt 129  Q
    ||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| ||||| |||||||||||| | ||| | || || || || |    
38177052 aaggctttcttgcattggtacactggtgagggaatggatgaaatggagttcactgaggccgagagtaacatgaatgatttggtggcagagtaccagcaat 38176953  T
130 atcaagatgctactgcagaggaggatgagtatgaaga 166  Q
    | || ||||||||||| || ||||| |||||||||||    
38176952 accaggatgctactgctgatgaggaagagtatgaaga 38176916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 244 - 324
Target Start/End: Complemental strand, 5934494 - 5934412
Alignment:
244 gcaacttcctgttgccggttcgtaatctc--tgttgtaaggggatacttttgttccggctgttatgaaattgtttctggtttt 324  Q
    ||||||||||||||||||||| |||||||  ||||||  |||||| ||| ||||| ||||||| |||||||| ||||| ||||    
5934494 gcaacttcctgttgccggttcataatctctttgttgttgggggatgcttatgttctggctgttctgaaattgattctgatttt 5934412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 26 - 140
Target Start/End: Complemental strand, 40916340 - 40916226
Alignment:
26 gagaaaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaa 125  Q
    ||||||||| || ||||||||||| || | |||||||||||||||||||||||| |||||||||||||| || ||||||||| | || || |||||||||    
40916340 gagaaaggcatttttgcattggtatactgctgaaggaatggatgagatggagtttactgaggctgagagtaatatgaatgatttggtttctgaatatcaa 40916241  T
126 cagtatcaagatgct 140  Q
    || ||||||||||||    
40916240 caatatcaagatgct 40916226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 127
Target Start/End: Original strand, 45320547 - 45320638
Alignment:
36 ttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaaca 127  Q
    |||||||||||||| || || |||||||||||||| ||||| || ||||| || || ||||| ||||||||||||||  | |||||||||||    
45320547 ttcttgcattggtataccggagaaggaatggatgaaatggaatttactgaagcagaaagcaatatgaatgatcttgttgctgaatatcaaca 45320638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 30 - 112
Target Start/End: Complemental strand, 11731908 - 11731826
Alignment:
30 aaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgt 112  Q
    ||||||||||||||||||||||| ||||| |||||||| || ||||||||||||||||||||||| |||||||||||||||||    
11731908 aaggctttcttgcattggtacactggtgagggaatggacgaaatggagttcactgaggctgagagtaacatgaatgatcttgt 11731826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 25 - 145
Target Start/End: Original strand, 34841829 - 34841949
Alignment:
25 ggagaaaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatca 124  Q
    |||| ||||||||||||||||||||||| |||||||| |||||||| ||||| ||||| || || ||||||||||||||||| || ||||| || || ||    
34841829 ggaggaaggctttcttgcattggtacactggtgaaggcatggatgaaatggaattcacagaagcagagagcaacatgaatgacctcgtgtctgagtacca 34841928  T
125 acagtatcaagatgctactgc 145  Q
     ||||| || ||||| |||||    
34841929 gcagtaccaggatgccactgc 34841949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 27 - 178
Target Start/End: Complemental strand, 45452473 - 45452322
Alignment:
27 agaaaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaac 126  Q
    ||||| ||||||||||||||||| || || || || ||||||||||||||||| ||||| || || |||||||||||||| ||||| || || || || |    
45452473 agaaaagctttcttgcattggtatactggagagggtatggatgagatggagtttactgaagcagaaagcaacatgaatgaccttgtctcagagtaccagc 45452374  T
127 agtatcaagatgctactgcagaggaggatgagtatgaagatgaagaggagga 178  Q
    | || ||||||||||||||||| || || | ||||||  ||||||| |||||    
45452373 aataccaagatgctactgcagatgaagaggggtatgactatgaagatgagga 45452322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 103
Target Start/End: Complemental strand, 53146064 - 53145991
Alignment:
30 aaggctttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaa 103  Q
    ||||| || ||||||||||| || || || ||||||||||||||||||||||| ||||| || || ||||||||    
53146064 aaggcctttttgcattggtatactggggagggaatggatgagatggagttcacggaggcagaaagtaacatgaa 53145991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University