View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20756_low_25 (Length: 247)
Name: NF20756_low_25
Description: NF20756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20756_low_25 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 21 - 247
Target Start/End: Complemental strand, 29660972 - 29660746
Alignment:
| Q |
21 |
agggcttgactgcaatcaaacctttgtcagagagaatatcaagggcatattttctctgattggggtgaatactttaatggaacgatccacgtccattcta |
120 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29660972 |
agggcttggctgcaatcaaacctttgtcagagagaatatcaagggcatattctctctgattggggtgaatactttaatggaacgatccacgtccaatcta |
29660873 |
T |
|
| Q |
121 |
agtatgcattttagggagctgaaatccttaattttgaaggtcgaaacaagtacctgcttgacagagttaatctctgataaactagggtcaccgagtataa |
220 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29660872 |
agtatgcattttagggagctcaaatacttaattttgaaggtcgaaacaagtacctgcttgacagagttaatctctgataaactagggtcactgagtataa |
29660773 |
T |
|
| Q |
221 |
catcttccacatacaaattattaagat |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29660772 |
catcttccacatacaaattattaagat |
29660746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University