View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20756_low_26 (Length: 239)
Name: NF20756_low_26
Description: NF20756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20756_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 226
Target Start/End: Original strand, 4973645 - 4973863
Alignment:
| Q |
8 |
attatacttgcttattgttcagaattgcttgttgtgcattgtggtttctttgtacaattgcatcaaacaatattagtaattattatttttgttttgatat |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4973645 |
attataattgcttattgttcagaattgcttattgtgcattgtggtttctttgtacaattgcatcaaacaatattagtaattattatttttgttttgatat |
4973744 |
T |
 |
| Q |
108 |
gatgaaattcgagtagggtcagacttcagaattaagaggaagaaactagatattataaggagaagttgattatattttcattcatacaatctttatttat |
207 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4973745 |
gacgaaattcgagtagggtcagacttcagaatttagaggaagaaactagatattataaggagaagttgattatattttcattcatacaatctttatttat |
4973844 |
T |
 |
| Q |
208 |
acatgtaataagataactg |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4973845 |
acatgtaataagataactg |
4973863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University