View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20756_low_29 (Length: 225)
Name: NF20756_low_29
Description: NF20756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20756_low_29 |
 |  |
|
| [»] scaffold0044 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0044 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 10116 - 10244
Alignment:
| Q |
1 |
ttattttgttataattagtgaagaaaacacattcaaagcatgtgttacttttgaagaagnnnnnnnngttgtcagcgtcatgattaactaaaatcggatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10116 |
ttattttgttataattagtgaagaaaaaacattcaaagcatgtgttagttttgaagaagaaaaaaaagttgtcagcgtcatgattaactaaaatcggatg |
10215 |
T |
 |
| Q |
101 |
cttaatatcgtaatgtttgaacaacgtgt |
129 |
Q |
| |
|
|||| |||| ||||||||||||||||||| |
|
|
| T |
10216 |
cttactatcataatgtttgaacaacgtgt |
10244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 137 - 175
Target Start/End: Complemental strand, 10581 - 10543
Alignment:
| Q |
137 |
gtcaatttgggatattttcatgtaaattaaattatatta |
175 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10581 |
gtcaatttggtatattttcatgtaaattaaattatatta |
10543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 225
Target Start/End: Original strand, 10668 - 10702
Alignment:
| Q |
191 |
aaatttcaatttgtccattttcaactctgcaaaat |
225 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10668 |
aaatttcaatttgtccattttcaacactgcaaaat |
10702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University