View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20756_low_30 (Length: 201)
Name: NF20756_low_30
Description: NF20756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20756_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 30842779 - 30842961
Alignment:
| Q |
8 |
ttgttgtgattaaatttgttgaagttgagaatgtctatttttcaaaagaaattgaaggttatattactatagttatgtggatgttatgcttaac-agtgt |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
30842779 |
ttgttgtgaataaatttgttgaagttgagaatctctatttttcaaaagaaattgaaggttgtattactatagtt--gtggatgttatgcttaaccagtgt |
30842876 |
T |
|
| Q |
107 |
agaatttctctttacgccctcaatatctctaagaccccgaaatcataacattgtagtccagaaaacggaaattgatcctcttcat |
191 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
30842877 |
agaatttctctttgcgccttcaatatctctaagaccccgaaatcataacattgtagcctagaaaacggaaattgatcctcttcat |
30842961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University