View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20756_low_8 (Length: 462)
Name: NF20756_low_8
Description: NF20756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20756_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 5e-63; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 172 - 302
Target Start/End: Original strand, 42763416 - 42763546
Alignment:
| Q |
172 |
catgttatgtatttggggatatagtggatcttcttgatccttatttgtcacatatttctgcatttgtgaattttacattcggtagttctttttctcatag |
271 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42763416 |
catgttatgaatttggggatatagtggatcttcttgatccttatttgtcacatatttctgcatttgtgaattttacattcggtagttctttttctcatag |
42763515 |
T |
|
| Q |
272 |
aaatcgtcagatttggatttggtctttttgc |
302 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
42763516 |
aaattgtcagatttggatttggtctttttgc |
42763546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 42763263 - 42763360
Alignment:
| Q |
19 |
tttaaagtcaatgggttagttagagaatagaagagtacaagaaacgttttttacttggctgtgttgattcttgtgaagaattaatgaggttaattaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42763263 |
tttaaagtcaatgggttagttagagaatagaagagtacaagaaacgttttttacttggctgtgttgattcttgtgaaaaattaatgaggttaattaac |
42763360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 370 - 456
Target Start/End: Original strand, 42763614 - 42763700
Alignment:
| Q |
370 |
ttttgttgattgggggtgatttatgtaaatacttttgttggtttcattgaatgagctcaaattcattcttttcctttaaaaagccta |
456 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42763614 |
ttttgtttatttggggtgatgtatgtaaatacttttgttggtttcattgaatgagttcaaattcattcttttcctttaaaaagccta |
42763700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University