View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20757_high_4 (Length: 201)
Name: NF20757_high_4
Description: NF20757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20757_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 47308980 - 47309152
Alignment:
| Q |
18 |
gattttgcttttggaacagtttatggactagagaggacgatgctccgtagctgttttcattgcaatggaagctcgggctggtctcacaagttctgatatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47308980 |
gattttgcttttggaacagtttatggactagagaggacaatgctccgtagctgttttcattgcaatggaagctcgggctggtctcacaagttctgatatt |
47309079 |
T |
|
| Q |
118 |
ccacatgtgtaannnnnnngtgattctactgttattgttgctcta---tattgtatgtccaataagagaataat |
188 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47309080 |
ccacatgtgtaa-ttttttgtgattctactgttattgttgctctatattattgtatgtccaataagagaataat |
47309152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University