View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20757_low_4 (Length: 322)
Name: NF20757_low_4
Description: NF20757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20757_low_4 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 70 - 322
Target Start/End: Original strand, 43961272 - 43961524
Alignment:
| Q |
70 |
aatggatataatgttagataggaagtgaagaaatccaccgttcaaccaaatgttggtgaagagtctccaggcttgacgacggtggacaatgttatgccat |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43961272 |
aatggatataatgttagataggaagtgaagaagtccaccgttcaaccaaatgttggtgaagagtctccaggcttgacgacggtggacagtgttatgccat |
43961371 |
T |
 |
| Q |
170 |
ctaagaactctcatattggttaatcttccaaaaaataatcacaaaaacaaacttggacggtaatggttccctctcttttttcaactccccctttctcatt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43961372 |
ctaagaactctcatattggttaatcttccaaaaaataatcacaaaaacaaacttggacagtaatggttccctctcttttttcaactccccctttctcatt |
43961471 |
T |
 |
| Q |
270 |
gtagtgattgtcactcttcatcttttatcttgcatattgtatctcagcaaaat |
322 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43961472 |
gtactgattgtcactcttcatcttttatcttgcatattgtatctcagcaaaat |
43961524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 43960271 - 43960331
Alignment:
| Q |
18 |
gaaaaagaacttgccaaatccgaattggcgttcgaggcaaatgccagaggataatggatat |
78 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43960271 |
gaaaaagaacttgccaaattcgaattggcgttcgaggcaaatgcgagaggataatggatat |
43960331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University