View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20758_high_15 (Length: 443)
Name: NF20758_high_15
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20758_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 18 - 427
Target Start/End: Original strand, 29768962 - 29769371
Alignment:
| Q |
18 |
acactcactctctcattcttcttctcagaagcgaaatcaaaatccgttagagagagaaaacaaaaatggcagcttccgatggaagcgagtactttgaaat |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29768962 |
acactcgctctctcattcttcttctcagaagcgaaatcaaaatccgttagagagagaaaacaaaaatggcagcttccgatggaagcgagtacttcgaaat |
29769061 |
T |
|
| Q |
118 |
cggatcaatcggaagcgagagttttgcgagagcgtcgaatgcagaatgggtggaggaagacgaagaggagcttcattgggcggcgctttcacgtttaccg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29769062 |
cggatcaatcggaagcgagagttttgcgagagcgtcgaatgcagaatgggtggaggaagacgaagaggagcttcattgggcggcgctttcacgtttaccg |
29769161 |
T |
|
| Q |
218 |
tcgcagaaacgcatcaactttgccgtcctccgtgcttcatcttcccgtcaaccttcaaaggaaaatgccgccgagaatttagtcgatgtgagaaaattga |
317 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29769162 |
tcgcagaaacgcatcaacttcgccgtcctccgtgcttcatcttcccgtcaaccttcaaaggaaaatgccggcgagaatttagtcgatgtgagaaaattga |
29769261 |
T |
|
| Q |
318 |
atcggtttaatcgtgaactcgtcgttaaaaaagcactcgctacaaatgatcaagataattataagcttctctccgctgttaaagaacgcctcaataggtt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29769262 |
atcggtttaatcgtgaactcgtcgttaaaaaagcactcgctacaaatgatcaagataattataagcttctctccgccgttaaagaacgcctcaataggtt |
29769361 |
T |
|
| Q |
418 |
cgttgttcat |
427 |
Q |
| |
|
|||||||||| |
|
|
| T |
29769362 |
cgttgttcat |
29769371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University