View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20758_high_32 (Length: 305)
Name: NF20758_high_32
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20758_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 289
Target Start/End: Complemental strand, 626597 - 626318
Alignment:
| Q |
11 |
ttattctcatttcagcggtcattcatagaagaatgttgcaacaacatcatatccctcaaacttgtatacgacattgttggaccaatcatcttaatctagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
626597 |
ttattctcatttcagcggtcattcatagaagaatgttgcaacaacatcatatccctcaaacttgtatacgacattgttggaccaatcatcttaatctagg |
626498 |
T |
|
| Q |
111 |
ttgtccctttg-tttcctttatagacgaatgannnnnnnnnaaaacttgttttgacctctaaatcaattgttaattgtgaagtcattggtttttcctcaa |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
626497 |
ttgtccctttgttttcctttatagacgaatgattttttttgaaaacttgttttgacctctaaatcaattgttaattgtgaagtcattggtttttcctcaa |
626398 |
T |
|
| Q |
210 |
tccttatattttctttctgtgannnnnnnnnncttgcaagagaaagatctagaactttgtttcttaacctgaaaaattat |
289 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
626397 |
tccttatattttctttctgtgattttttttttcttgcaagagaaagatctagaactttgtttcttaacctgaaaaattat |
626318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University