View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20758_high_45 (Length: 242)
Name: NF20758_high_45
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20758_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 31464125 - 31464334
Alignment:
| Q |
1 |
aatggttggtgatcattttgaacccagtttttgggtttttattcttaattttctggcatattgtaggtttaggttatatacatcacatcctggtcgaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31464125 |
aatggttggtgatcattttgaacccagtttttgggtttttattcttaattttctggcatattgtaggtttaggttatatacatcacatcctggtcgaaat |
31464224 |
T |
 |
| Q |
101 |
agggtggcatggcccactttgccccttcatagttcatttcatgtgaaaatgtttatatggtgttaaaaatgttggttttagtnnnnnnnnnncattatgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31464225 |
agggtggcatggcccactttgccccttcata-------tcatgtgaaaatgtttatatggtgttaaaaatgttggttttagt--aaaaaaaacattatgg |
31464315 |
T |
 |
| Q |
201 |
aaaggaaaacgtgaaagag |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31464316 |
aaaggaaaacgtgaaagag |
31464334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University