View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20758_high_50 (Length: 231)
Name: NF20758_high_50
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20758_high_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 19109138 - 19108936
Alignment:
| Q |
16 |
aaaatctctaatgcacatggcagtttagtacaactgtgatcttcagagaaacttgtttccatattgcttgaggaagcccctcaaaggaggactaaatttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19109138 |
aaaatctctaatgcacatggcagtttagtacaactgtgatcttcagagaaacttgtttccatattgctcgaggaagcccctcaaaggaggactaaatttg |
19109039 |
T |
 |
| Q |
116 |
aacctgctgcatattggtctgcactgatgaatgatctccaataagagtggctttacaccactctaccaaatatgattaagcttcaaagctctttgttgaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19109038 |
aacctgctgcatattggtctgcactgatgaatgatctccaataagagtggcttgacaacactctaccaaatatgattgagcttcaaagctctttgttgaa |
19108939 |
T |
 |
| Q |
216 |
tct |
218 |
Q |
| |
|
||| |
|
|
| T |
19108938 |
tct |
19108936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University