View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20758_high_52 (Length: 221)
Name: NF20758_high_52
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20758_high_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 43089338 - 43089142
Alignment:
| Q |
19 |
aatgagagtaacaggaacgagtttacagcttcaattcctattcacagcagaagattatcatcatcttttgatgctacaatgaacagttatgatattggaa |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089338 |
aatgagagtaacaggaacgagtacacagcttcaattcctattcacagcagaagattatcatcatcttttgatgctacaatgaacagttatgatattggaa |
43089239 |
T |
 |
| Q |
119 |
gtccaaaaatagtagaagttgatactggaagaccaaaatcaaggtctagaagaagcaatacatcaatttcagattttggagatgacccttcatttca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089238 |
gtccaaaaatagtagaagttgatactggaagaccaaaatcaaggtctagaagaagcaatacatcaatttcagattttggagatgacccttcatttca |
43089142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University