View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20758_high_53 (Length: 213)
Name: NF20758_high_53
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20758_high_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 35319625 - 35319446
Alignment:
| Q |
18 |
caatggtgtaacaccatcaactgttctcacatttgggtcagcgtggtggtcgagcaaaacagccaccatatccggtgagaccatctccgctgcaatgtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35319625 |
caatggtgtaacaccatcaactgttctcacatttgggtcagcgtggtggtcgagcaaaacagccaccatatccggtgagaccatctccgctgcaatgtga |
35319526 |
T |
|
| Q |
118 |
agcggggttttaccggttggaccagccgggaagttaacatcggctgcaccgagttccaataaggctttcacaacttctct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35319525 |
agcggggttttaccggttggaccagccgggaagttaacatcggctgcaccgagttccaataaggctttcacaacttctct |
35319446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University