View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20758_high_55 (Length: 206)
Name: NF20758_high_55
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20758_high_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 34274764 - 34274954
Alignment:
| Q |
1 |
tttacttgtgcattttggttcagaacaggaaactaaaaaggtgaagatggctaagcatgtcattaaggtggagtccgttcctgaggaacaaatcgacatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34274764 |
tttacttgtgcattttggttcagaacaggaaactaaaaaggtgaagatggctaagcatgtcattaagttggagtccgttcctgaggaacaaatcgacatt |
34274863 |
T |
 |
| Q |
101 |
acaagtgcagaagtcgttcctgatgcatctaacgaaattgaggaccctgatgcaactgagtattcaagttcgtttgctgataccatctctg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34274864 |
acaagtgcagaagtcgttcctgatgcatctaacgaaattgaggaccctgatgcaactgagtattcaagttcgtttgctgataccatctctg |
34274954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 140 - 183
Target Start/End: Original strand, 34281707 - 34281750
Alignment:
| Q |
140 |
gaggaccctgatgcaactgagtattcaagttcgtttgctgatac |
183 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
34281707 |
gaggaccctgatgcaactgaatattcgagttcctttgctgatac |
34281750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 20229811 - 20229778
Alignment:
| Q |
23 |
gaacaggaaactaaaaaggtgaagatggctaagc |
56 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
20229811 |
gaacaggtaactaaaaaggtgaagatggctaagc |
20229778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University