View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20758_low_23 (Length: 367)
Name: NF20758_low_23
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20758_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 21 - 352
Target Start/End: Original strand, 6825038 - 6825369
Alignment:
| Q |
21 |
tgaggaaactgtgtccaaatttcgataaagttgatggattagaaacggttttagaagttccaattcctgaagatatgtggactggaattggaagcagtgg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6825038 |
tgaggaaactgtgtccaaatttcgataaagttgatggattagaaacggttttagaagttccaattcctgaagatatgtggactggaattggaagcagtgg |
6825137 |
T |
 |
| Q |
121 |
tccaaatcggtggcagaatcttcgtgctttgatgaaagcacaaatttctaacgataaatgttcgcatctttctgctacttctaataatgaattcattgct |
220 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6825138 |
ttcaaatcggtggcagaatcttcgtgctttgatgaaagcacaaatttctaacgataaatgttcgcatctttctgctacttctaataatgaattcattgct |
6825237 |
T |
 |
| Q |
221 |
ttgcttaaacttgttggttctcccttgattcctcttcaggttcaatgtgatcatactttgactcgtcctcttcaagattctaatatcgtaagcatccttt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6825238 |
ttgcttaaacttgttggttctcccttgattcctcttcaggttcaatgtgatcatactttgactcgtcctcttcaagattctaatatcgtaagcatccttt |
6825337 |
T |
 |
| Q |
321 |
cttcatcgatttcgtatttctatgtatttatt |
352 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
6825338 |
cttcatcgatttcgtatttgtatgtatttatt |
6825369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 198 - 285
Target Start/End: Original strand, 52296012 - 52296099
Alignment:
| Q |
198 |
cttctaataatgaattcattgctttgcttaaacttgttggttctcccttgattcctcttcaggttcaatgtgatcatactttgactcg |
285 |
Q |
| |
|
|||| ||||||||||||| || |||||||| ||||| ||| |||| | ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52296012 |
cttcaaataatgaattcaccgcattgcttaagcttgtgggtgctcctcttattcctcttcaggttcaatctgatcatactttgactcg |
52296099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University