View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20758_low_46 (Length: 242)

Name: NF20758_low_46
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20758_low_46
NF20758_low_46
[»] chr3 (1 HSPs)
chr3 (1-219)||(31464125-31464334)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 31464125 - 31464334
Alignment:
1 aatggttggtgatcattttgaacccagtttttgggtttttattcttaattttctggcatattgtaggtttaggttatatacatcacatcctggtcgaaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31464125 aatggttggtgatcattttgaacccagtttttgggtttttattcttaattttctggcatattgtaggtttaggttatatacatcacatcctggtcgaaat 31464224  T
101 agggtggcatggcccactttgccccttcatagttcatttcatgtgaaaatgtttatatggtgttaaaaatgttggttttagtnnnnnnnnnncattatgg 200  Q
    |||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||          ||||||||    
31464225 agggtggcatggcccactttgccccttcata-------tcatgtgaaaatgtttatatggtgttaaaaatgttggttttagt--aaaaaaaacattatgg 31464315  T
201 aaaggaaaacgtgaaagag 219  Q
    |||||||||||||||||||    
31464316 aaaggaaaacgtgaaagag 31464334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University