View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20758_low_51 (Length: 231)

Name: NF20758_low_51
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20758_low_51
NF20758_low_51
[»] chr5 (1 HSPs)
chr5 (16-218)||(19108936-19109138)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 19109138 - 19108936
Alignment:
16 aaaatctctaatgcacatggcagtttagtacaactgtgatcttcagagaaacttgtttccatattgcttgaggaagcccctcaaaggaggactaaatttg 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
19109138 aaaatctctaatgcacatggcagtttagtacaactgtgatcttcagagaaacttgtttccatattgctcgaggaagcccctcaaaggaggactaaatttg 19109039  T
116 aacctgctgcatattggtctgcactgatgaatgatctccaataagagtggctttacaccactctaccaaatatgattaagcttcaaagctctttgttgaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||    
19109038 aacctgctgcatattggtctgcactgatgaatgatctccaataagagtggcttgacaacactctaccaaatatgattgagcttcaaagctctttgttgaa 19108939  T
216 tct 218  Q
    |||    
19108938 tct 19108936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University