View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20758_low_52 (Length: 228)
Name: NF20758_low_52
Description: NF20758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20758_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 34274933 - 34275162
Alignment:
| Q |
1 |
tcgtttgctgataccatctctgatgctgaaaatggttcagaagggaatggcgatgaagtgcagtctgagctctttggtgagaatggcatggcatgccccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34274933 |
tcgtttgctgataccatctctgatgctgaaaatggttcagaagggaatggcgatgaagtgcagtctgagctctttggtgagaatggcatggcatgccccc |
34275032 |
T |
 |
| Q |
101 |
aggatccatttggtcctgacgtcccaacaaggtgat----tttactcaaaatcagttaattttgtatcatcttgctaatgaaaatgttgagtaagaaagg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275033 |
aggatccatttggtcctgacgtcccaacaaggtgatttaatttactcaaaatcagttaattttgtatcatcttgctaatgaaaatgttgagtaagaaagg |
34275132 |
T |
 |
| Q |
197 |
aggttatgtctttgcaagtcctttgatact |
226 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
34275133 |
aggttatgtctttgcaagtccttagatact |
34275162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University