View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20759_high_15 (Length: 376)
Name: NF20759_high_15
Description: NF20759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20759_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 14 - 318
Target Start/End: Original strand, 51706489 - 51706793
Alignment:
| Q |
14 |
atattcggatgcggggtttcgattgcgccaaattcattgagcaagaaagcaattggaattgaaaggagaaatgtttgtggaggattgttgatagagtgtt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51706489 |
atattcggatgcggggtttcgattgcgccaaattcattgagaaagaaagcaattggaattgaaaggagaaatgtttgtggaggattgttgatagagtgtt |
51706588 |
T |
 |
| Q |
114 |
catcgaggccacagaagaaatcaactgcacatcacatgaagacgaggcccagaaaatcatcactgtcagataggaatcggaaaccaacagagtatgctcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51706589 |
catcgaggccacagaagaaatcaactgcacatcacatgaagacgagacccagaaaatcatcactgtcggataggaatcggaaaccaacagagtatgctcc |
51706688 |
T |
 |
| Q |
214 |
gttgccaccactgcctcctgattttacaattgtcatttctgctgatgcatcttcaacggctactgttgttcctccaccccctactccttctacttgattc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
51706689 |
gttgccaccactgcctcctgattttacaattgtcattcctgctgatgcatcttcaacggctactgttgttcctccgcctcctactccttctacttgattc |
51706788 |
T |
 |
| Q |
314 |
ggtac |
318 |
Q |
| |
|
||||| |
|
|
| T |
51706789 |
ggtac |
51706793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University