View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20759_high_27 (Length: 241)
Name: NF20759_high_27
Description: NF20759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20759_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 93 - 128
Target Start/End: Complemental strand, 6519545 - 6519510
Alignment:
| Q |
93 |
ctactcaaaacagtctttcatttgaagcaactaata |
128 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6519545 |
ctacttaaaacagtctttcatttgaagcaactaata |
6519510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University