View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20759_high_27 (Length: 241)

Name: NF20759_high_27
Description: NF20759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20759_high_27
NF20759_high_27
[»] chr2 (1 HSPs)
chr2 (93-128)||(6519510-6519545)


Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 93 - 128
Target Start/End: Complemental strand, 6519545 - 6519510
Alignment:
93 ctactcaaaacagtctttcatttgaagcaactaata 128  Q
    ||||| ||||||||||||||||||||||||||||||    
6519545 ctacttaaaacagtctttcatttgaagcaactaata 6519510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University