View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20759_high_32 (Length: 220)
Name: NF20759_high_32
Description: NF20759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20759_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 32475465 - 32475276
Alignment:
| Q |
19 |
cagccaataaccaaaaatgataattggacaacaaaatttagtaacacaagaaaatgacaccaaatttatcgaccataaggatttgagggattcacaaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32475465 |
cagccaataaccaaaaatgataattgggcaacaaaatttagtaacacaagaaaatgacaccaaatttatcaaccataaggatttgagggattcacaaaac |
32475366 |
T |
|
| Q |
119 |
cagacatagtcgaattctcgctcgatgaaaggataaaacctccccttgctaggataggaagctccatgaaaaaacttgaacgattgatga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
32475365 |
cagacatagtcgaattctcgctcgatgaaaggataaaacctccccttgctaggataggaagctccatcgaaaaacttgaacgattaatga |
32475276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University