View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20759_low_26 (Length: 249)
Name: NF20759_low_26
Description: NF20759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20759_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 3541330 - 3541567
Alignment:
| Q |
1 |
aattaacaaaaattactactcaaggtaaagtagatgattatgcacggaatgagaggaagaagttgtgaaagagatcgaaaaaatattgaaaaatgtttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3541330 |
aattaacaaaaattactactcaaggtaaagtagatgattatgcacggaatgagaggaagaagttgtgaaagagatcgaaaaaatattgaaaaatgtttgg |
3541429 |
T |
|
| Q |
101 |
attttaatattctaatattcaaattgtgttgcttaacatatggaatagaaatattaattttagttgcnnnnnnnnnnnngtatattaattttattattaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3541430 |
attttaatattctaatattcaaattgtgttgcttaacatatggaatagaaatattaattttagttgc--aaaaaaaaaagtatattaattttattattag |
3541527 |
T |
|
| Q |
201 |
ccctgcctaaaggatcacacaaacgttttttatagaataa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3541528 |
ccctgcctaaaggatcacacaaacgttttttatagaataa |
3541567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University