View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20760_high_16 (Length: 340)

Name: NF20760_high_16
Description: NF20760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20760_high_16
NF20760_high_16
[»] scaffold0085 (1 HSPs)
scaffold0085 (19-332)||(45154-45467)


Alignment Details
Target: scaffold0085 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 19 - 332
Target Start/End: Complemental strand, 45467 - 45154
Alignment:
19 agtttttgtttaagcatgacaggggttttatagaaaaaggctgtttactgaaatttggattgttatatcaaggtttttgatgtctttatgatcgcataga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45467 agtttttgtttaagcatgacaggggttttatagaaaaaggctgtttactgaaatttggattgttatatcaaggtttttgatgtctttatgatcgcataga 45368  T
119 agtatatttaacaattattctctgtaatatcgtggattatgtcgtgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttgga 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45367 agtatatttaacaattattctctgtaatatcgtggattatgtcgtgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttgga 45268  T
219 tgatgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgattttc 318  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45267 tgatgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgattttc 45168  T
319 ttggtacctttgct 332  Q
    ||||||||||||||    
45167 ttggtacctttgct 45154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University