View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20760_high_32 (Length: 208)
Name: NF20760_high_32
Description: NF20760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20760_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 35094391 - 35094570
Alignment:
| Q |
20 |
atgaactgtgacaaccacttcctaatatctcagcagcggctctcaaaagatcttgcaaatcaaattgtgctgatacttcttccctcacaaaggacaactt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094391 |
atgaactgtgacaaccacttcctaatatctcagcagcggctctcaaaagatcttgcaaatcaaattgtgctgatacttcttccctcacaaaggacaactt |
35094490 |
T |
 |
| Q |
120 |
gctatctccttttctgctactggtattactgcttgcgcgtgatcttaccgaaccctcgtctgtattattatttgatgatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094491 |
gctatctccttttctgctactggtattactgcttgtgcgtgatcttaccgaaccctcgtctgtattattatttgatgatg |
35094570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University