View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20760_low_17 (Length: 340)
Name: NF20760_low_17
Description: NF20760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20760_low_17 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 19 - 332
Target Start/End: Complemental strand, 45467 - 45154
Alignment:
| Q |
19 |
agtttttgtttaagcatgacaggggttttatagaaaaaggctgtttactgaaatttggattgttatatcaaggtttttgatgtctttatgatcgcataga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45467 |
agtttttgtttaagcatgacaggggttttatagaaaaaggctgtttactgaaatttggattgttatatcaaggtttttgatgtctttatgatcgcataga |
45368 |
T |
 |
| Q |
119 |
agtatatttaacaattattctctgtaatatcgtggattatgtcgtgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45367 |
agtatatttaacaattattctctgtaatatcgtggattatgtcgtgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttgga |
45268 |
T |
 |
| Q |
219 |
tgatgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgattttc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45267 |
tgatgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgattttc |
45168 |
T |
 |
| Q |
319 |
ttggtacctttgct |
332 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45167 |
ttggtacctttgct |
45154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University