View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20760_low_26 (Length: 236)
Name: NF20760_low_26
Description: NF20760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20760_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 3654915 - 3654697
Alignment:
| Q |
1 |
atcaatttgatcatgaatattgaaaaacctctcaggttgaaattcattagggttggaccatactagtgggtccctttgcaatttccataggttaataagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3654915 |
atcaatttgatcatgaatattgaaaaacctctcaggttgaaatttattagggttggaccatactagtgggtccctttgcaatttccataggttaataaac |
3654816 |
T |
|
| Q |
101 |
aaacgagtgcctttggtgactttgtagcctgccacgtggcaatcatcagtggcttctcttattcctgttaagggtgctggtgggtataaacgaagtgtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3654815 |
aaacgagtgcctttggtgactttgtagcctgccacgtggcaatcatcagtggcttctcttattcctgttaagggtgctggtgggtataaacgaagtgtct |
3654716 |
T |
|
| Q |
201 |
ctttgataatggcttgaag |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3654715 |
ctttgataatggcttgaag |
3654697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 35026421 - 35026375
Alignment:
| Q |
173 |
ggtgctggtgggtataaacgaagtgtctctttgataatggcttgaag |
219 |
Q |
| |
|
|||||||||||||||| ||| | ||| |||||||||||||||||||| |
|
|
| T |
35026421 |
ggtgctggtgggtatagacgcaatgtttctttgataatggcttgaag |
35026375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University