View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20760_low_32 (Length: 214)
Name: NF20760_low_32
Description: NF20760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20760_low_32 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 25 - 214
Target Start/End: Original strand, 27759468 - 27759655
Alignment:
| Q |
25 |
gtacagacttacgataatggtgaaaatattatataaaaaataattttgtcatatctttgaactataaaatgcacaacaaaaaagtcattttttgctgttg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27759468 |
gtacagacttacgataatggtgaaaatattatataaaaaataatt--gtcatatctttgaactataaaatgcacaacaaaaaagtcattttttgctgttg |
27759565 |
T |
|
| Q |
125 |
nnnnnnntaataattcaacgttcaagcctttgatggcaatctctctaaagcaaaagnnnnnnnggtgaaaagtctagtgcaaacgtttat |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
27759566 |
aaaaaaataataattcaacgttcaagtctttgatggcaatctctctaaagcaaaaaaaattttggtgaaaaatctagtgcaaacgtttat |
27759655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University