View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20761_high_5 (Length: 420)
Name: NF20761_high_5
Description: NF20761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20761_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 18 - 326
Target Start/End: Complemental strand, 21269056 - 21268748
Alignment:
| Q |
18 |
aatgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacggttacttttccggtttcactctct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269056 |
aatgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacggttacttttccggtttcactctct |
21268957 |
T |
 |
| Q |
118 |
gctttcaccgtatcaacaccttaaaaacagaaacatggttgttcaattttaacgattgaaaaatgaattgaagaacaatgatgaaaacccagatcggaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268956 |
gctttcaccgtatcaacaccttaaaaacagaaacatggttgttcaattttaacgattgaaaaatgaattgaagaacaatgatgaaaacccagatcggaaa |
21268857 |
T |
 |
| Q |
218 |
aaatgtgtagaaacagaggagtgtgagaaaaatgatacctttgatactgttaaggtgtttggttactttgttagcgcaaccttcgcaatgcatatagact |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268856 |
aaatgtgtagaaacagaggagtgtgagaaaaatgatacctttgatgccgttaaggtgtttggtgactttgttagcgcaaccttcgcaatgcatatagact |
21268757 |
T |
 |
| Q |
318 |
ttcaaaacc |
326 |
Q |
| |
|
||||||||| |
|
|
| T |
21268756 |
ttcaaaacc |
21268748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University