View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20761_low_10 (Length: 259)
Name: NF20761_low_10
Description: NF20761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20761_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 152 - 258
Target Start/End: Original strand, 50784034 - 50784140
Alignment:
| Q |
152 |
tagttctgcacaacgtcgctgtctgcaccatgcaagacaacttgtcagaccacacacactttttatcacaaaaaacaaattaatactatcatagcatctt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50784034 |
tagttctgcacaacgtcgctgtctgcaccatgcaagacaacttgtcagaccacacacactttttatcacaaaaaacaaattaatactatcatagcatctt |
50784133 |
T |
 |
| Q |
252 |
tcattca |
258 |
Q |
| |
|
||||||| |
|
|
| T |
50784134 |
tcattca |
50784140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 6 - 89
Target Start/End: Original strand, 50783888 - 50783971
Alignment:
| Q |
6 |
aaagaacatgttgataagagcagatattatttgttcagacataagtttggcactcgtgactcacactgtccttgccagccaacc |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50783888 |
aaagaacatgttgataagagcagatattatttgttcagacataagtttggcactcgtgactcacactgtccttgccagccaacc |
50783971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University