View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20761_low_11 (Length: 233)
Name: NF20761_low_11
Description: NF20761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20761_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 12 - 215
Target Start/End: Complemental strand, 28668896 - 28668692
Alignment:
| Q |
12 |
agattattctgatttttgtagtatttcttttacatatattttggnnnnnnnnttaatt-tttaatgagattttgtgtatgttgtgtctgtttctcaatta |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| | || ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28668896 |
agattcttctgatttttgtagtatttcttttacatatattttggaaaaaaaataaaaaatttaatgagatttagtgtatgttgtgtctgtttctcaatta |
28668797 |
T |
 |
| Q |
111 |
agaagcagaaactatttatgggttttatctgaattcgagaaaactgtttctgggtctttgtcttagtgtcttaagagtatgaaagacacgttttttgctt |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28668796 |
agaagcagaaactatttacgggttttatctgaattcgagaaaactgtttctgggtctttgtcttagtgtcttaagagtatgaaagacacgttttttgctt |
28668697 |
T |
 |
| Q |
211 |
aggat |
215 |
Q |
| |
|
||||| |
|
|
| T |
28668696 |
aggat |
28668692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University