View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20761_low_13 (Length: 214)
Name: NF20761_low_13
Description: NF20761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20761_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 27 - 198
Target Start/End: Original strand, 4642220 - 4642386
Alignment:
| Q |
27 |
gacacattaacatcaataataatttaaaaagtgacataactgaatagcttcgtgtcggtatttgacattgacacttgtaacactagacttgacttctatt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4642220 |
gacacattaacatcaataataatttaaaaagtgacataactgaatagcttcg-----gtatttgacattgacacttgtaacactagacttgacttctatt |
4642314 |
T |
|
| Q |
127 |
ataagtgttgatgctacaaagtttgttaatgttactgtttttgtgtgtgctgggtttgtgaagctgagtttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4642315 |
ataagtgttgatgctacaaagtttgttaatgttactgtttttgtgtgtgctgggtttgtgaagctgagtttt |
4642386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University