View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20761_low_14 (Length: 208)
Name: NF20761_low_14
Description: NF20761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20761_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 30947053 - 30947234
Alignment:
| Q |
14 |
gatgaagaaaagctgttacatgaaattccaagtttgaagttatgtaagaaacatatcaaagtgccggtagttcttattcttttaattttccacgctttca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30947053 |
gatgaagaaaagctgttacatgaaattccaagtttgaagttatgtaagaaacatatcaaagtgccggtagttcttattcttttgattttccacgctttca |
30947152 |
T |
 |
| Q |
114 |
ctttcgttcgttctctctgttctccctcgccatttccgttctctcccttcgacattcccaatcaacactcgatcatcttcat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30947153 |
ctttcgttcgttctctctgttctccctcgccatttccgttctctcccttcgacattcccaatcaacactcgatcatcttcat |
30947234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University