View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20762_high_27 (Length: 272)
Name: NF20762_high_27
Description: NF20762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20762_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 48965728 - 48965984
Alignment:
| Q |
1 |
ttttctgattcactacatatgatgtttgcatcattgttttgttggcttttgcatttgatcattcaacattgcatctgtttactaaaacaaaaatcacaaa |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48965728 |
ttttctgattaactacatatgatgtttgctacattgttttgttggcttt-gcattggatcattcaacattgcatctgtttactaaaaagaaaatcacaaa |
48965826 |
T |
|
| Q |
101 |
cactgataatgaatgttaattagtctaatttaagaaccagcaatagcagcaatgcctggtgctctttcgtaagagcaacaaactgtgatgtgaggccaaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48965827 |
cactaataatgaatgttaattagtataatttaagaaccagcaatagcagcaatgcctggtgctctttcttaagagcaacaaactgtgatgtgaggccaaa |
48965926 |
T |
|
| Q |
201 |
tggttataattggcttccatggagctcttcttttctaaaatcatatagcaacctgatg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965927 |
tggttataattggcttccatggagctcttcttttctaaaatcatatagcaacctgatg |
48965984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University