View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20762_high_32 (Length: 254)
Name: NF20762_high_32
Description: NF20762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20762_high_32 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 254
Target Start/End: Complemental strand, 29039889 - 29039649
Alignment:
| Q |
14 |
aagaatattctaccactgatcctgctgaccagaaccagtcaacaattacttcacctttactatcctcccctgatattggtcatccagaaggtacacttgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29039889 |
aagaatattctaccactgatcctgctgaccagaaccagtcaacaattacttcacctttactatcctcctctgatattggtcatccagaaggtacacttgg |
29039790 |
T |
 |
| Q |
114 |
tgatgcagatctgattaagaatgtgaaaccgacgtcagatgttaatcatggacgtgaaagaatgaattctacaatttcctcaaatggagtgcagagcgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29039789 |
tgatgcagatctgattaagaatgtgaaaccgacgtcagatgttaatcatggacgtgaaagaatgaattctacaatttcctcaaatggagtgcagagcgtt |
29039690 |
T |
 |
| Q |
214 |
gtgcaggatttcatagatttttcagaaaaagagcagtcgct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29039689 |
gtgcaggatttcatagatttttcagaaaaagagcagtcgct |
29039649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University