View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20762_high_35 (Length: 238)
Name: NF20762_high_35
Description: NF20762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20762_high_35 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 5052469 - 5052690
Alignment:
| Q |
17 |
acctgccaggctgcctgtttcattccatggtgttacattaacctaggagagatgatttggtcactttcaggtggattgtgaaatactctactagtatttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5052469 |
acctgccaggctgcctgtttcattccatggtgttacattaacctaggagagatgatttggtcactttcaggtggattgtgaaatactctactagtatttc |
5052568 |
T |
 |
| Q |
117 |
gatttttaagtgtatgttcatatgtttgtgatattcagatttgttttccctttaaatattgaaaagattctagtagttgtgaatctatggtgtgttacaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5052569 |
gatttttaagtgtatgttcatatgtttgtgatattcagatttgttttccctttaaatattgaaaagcttctagtagttgtgaatctatggtgtgttacaa |
5052668 |
T |
 |
| Q |
217 |
cttacaagtactagtacttcac |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5052669 |
cttacaagtactagtacttcac |
5052690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 42 - 121
Target Start/End: Original strand, 5048966 - 5049045
Alignment:
| Q |
42 |
catggtgttacattaacctaggagagatgatttggtcactttcaggtggattgtgaaatactctactagtatttcgattt |
121 |
Q |
| |
|
|||||| ||| |||||||||||||||| ||||| | ||||||||||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
5048966 |
catggttttagattaacctaggagagaggatttagacactttcaggtggattgtgaattactcttctagtattttgattt |
5049045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University