View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20762_high_36 (Length: 237)
Name: NF20762_high_36
Description: NF20762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20762_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 16 - 116
Target Start/End: Complemental strand, 2618740 - 2618640
Alignment:
| Q |
16 |
atgaagtaggttagagaaacagctaggattagccatagcataatctttgctgagtttgaatgtgaaggtcgttgttgtgttgtaggattcactaaggttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618740 |
atgaagtaggttagagaaacagctaggattagccatagcataatctttgctgagtgtgaatgtgaaggtcgttgttgtgttgtaggattcactaaggttg |
2618641 |
T |
 |
| Q |
116 |
g |
116 |
Q |
| |
|
| |
|
|
| T |
2618640 |
g |
2618640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University