View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20762_low_23 (Length: 309)
Name: NF20762_low_23
Description: NF20762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20762_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 72 - 305
Target Start/End: Original strand, 38050772 - 38051009
Alignment:
| Q |
72 |
gaattacagactagtttggtttgtctttgtatttacca----ctaccataaacacgaggaagaatcaactttacggtggtggctgctgccactattgttt |
167 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38050772 |
gaattacagactggtttggtttgtctttgtatttaccatgcactaccataaacacgaggaagaatcaactttacggtggtggctgctgccactattgttt |
38050871 |
T |
 |
| Q |
168 |
aaaagctgtgaaaaccttcttctacggtaataaaacccgcatttaaaccttggaaaaaacaccaactttcttcttagtccacgagcataccttaacttta |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38050872 |
aaaagctgtgaaaaccttcttctacggtaataaaacccgcatttaaaccttggaaaaaacaccaactttcttcttagtccacgagcataccttaacttta |
38050971 |
T |
 |
| Q |
268 |
accatacaactttcttagcacgaactaaagatcctttg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38050972 |
accatacaactttcttagcacgaactaaagatcctttg |
38051009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 38050696 - 38050740
Alignment:
| Q |
1 |
aacatacatacatacatgttcgaaactctaatcttaaaacttagt |
45 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
38050696 |
aacatacatacatacatgttccaaactctaatcataaaacttagt |
38050740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University