View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20762_low_30 (Length: 259)
Name: NF20762_low_30
Description: NF20762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20762_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 13 - 240
Target Start/End: Complemental strand, 29039226 - 29038998
Alignment:
| Q |
13 |
aatataagaaaatatgaaacttttgtgcacttatgcataatgtgcattttcattgtagactttaactttgatacactgtcggtgtaaaaaggtgtcgaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29039226 |
aatataagaaaatatgaaacttttgtgcacttatgcataatgtgcattttcattttagactttaactttgatacactgtcggtgtaaaaaggtgtcgaca |
29039127 |
T |
|
| Q |
113 |
aatcattgacaatagttgtgattgaagtcaaatgtttttaaatgaactaatggttataatcgattgatgtgt-nnnnnnntttacactgacaatgtatat |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
29039126 |
aatcattgataatagttgtgattgaagtcaaatgtttttaaatgaactaatgattataattgattgacgtgtaaaaaacatttacactgacaatgtatat |
29039027 |
T |
|
| Q |
212 |
gaattaattctttcatataactttattgt |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
29039026 |
gaattaattctttcatattactttattgt |
29038998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 178
Target Start/End: Complemental strand, 1194293 - 1194247
Alignment:
| Q |
132 |
gattgaagtcaaatgtttttaaatgaactaatggttataatcgattg |
178 |
Q |
| |
|
||||||||||||||||||||||| |||| ||| |||||||| ||||| |
|
|
| T |
1194293 |
gattgaagtcaaatgtttttaaaggaaccaatagttataattgattg |
1194247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University