View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20762_low_38 (Length: 236)
Name: NF20762_low_38
Description: NF20762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20762_low_38 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 236
Target Start/End: Original strand, 24419889 - 24420109
Alignment:
| Q |
15 |
agtcttttgcactttcagagatactaggccatggatccgatgagaaatcaagatcactattcaaaatggcctcaaatatatcttgttccgattctagtac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24419889 |
agtcttttgcactttcagagatactaggccatggatccgatgagaaatcaagatcgctattcaaaatggcctcaaatatatcttgttccgattctagtac |
24419988 |
T |
 |
| Q |
115 |
caaggatcaagataaatgttatactatgatttgaaccaggaaacatttgaaagaaatataaattaagcaaatagctagattggaattaatataatgggtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24419989 |
caaggatcaagataaatgttatactatgttttgaaccaggaaacatttgaaagaaat-taaattaagcaaatagctagattggaattaatataatgggtt |
24420087 |
T |
 |
| Q |
215 |
tgatatctgaagaactcttacc |
236 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24420088 |
tgatatctgaagaactcttacc |
24420109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 65
Target Start/End: Complemental strand, 43463428 - 43463378
Alignment:
| Q |
15 |
agtcttttgcactttcagagatactaggccatggatccgatgagaaatcaa |
65 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||| |||||||| |||||||||| |
|
|
| T |
43463428 |
agtctttggcactttcagaaatacttggccaaggatccgaagagaaatcaa |
43463378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University