View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20763_high_16 (Length: 250)
Name: NF20763_high_16
Description: NF20763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20763_high_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 17106759 - 17106523
Alignment:
| Q |
14 |
gaagtaaaaggaagcttggacttcaaattctgtatgtagatttcatcaagaacatcctcagcatccattatagcatctttgacattacaaatccatgtcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106759 |
gaagtaaaaggaagcttggacttcaaattctgtatgtagatttcatcaagaacatcctcagcatccattatagcatctttgacattacaaatccatgtcc |
17106660 |
T |
 |
| Q |
114 |
tcacagtagatcttctgatctgctgctgctcagcatattcaacaacagcattgatggaaatcaaactattgtttaatttcatcagcaaattcccatcgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106659 |
tcacagtagatcttctgatctgctgctgctcagcatattcaacaacagcattgatggaaatcaaactattgtttaatttcatcagcaaattcccatcgag |
17106560 |
T |
 |
| Q |
214 |
tttagttcgaaaataatccatcatttcggttgaagct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106559 |
tttagttcgaaaataatccatcatttcggttgaagct |
17106523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University