View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20763_low_15 (Length: 255)
Name: NF20763_low_15
Description: NF20763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20763_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 46765521 - 46765280
Alignment:
| Q |
1 |
atatcttcccttcgttccatcccacaaaagcgcggcctcttttttgctctattctcaactgccatgagtgtcaatagttaggattattatgtaacttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46765521 |
atatcttcccttcgttccatcccacaaaagcgcggcctcttttttgctctattctcaactgccatgagtgtcaatagttaggattattatgtaacttaaa |
46765422 |
T |
|
| Q |
101 |
cagcaaacatgaggttaatggtaacatgaacgagacatacttgatcattttctagcaatgctctccagttttgcatctcaacaagtgccttagcagaacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46765421 |
cagcaaacatgaggttaatggtaacatgaacgagacatacttgatcattttctagcaatgctctccagttttgcatctcaacaagtgccttagcagaacg |
46765322 |
T |
|
| Q |
201 |
gtaggagagagcgatccgataattcaaatctccaagccatat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46765321 |
gtaggagagagcgatccgataattcaaatctccaagccatat |
46765280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 145 - 242
Target Start/End: Complemental strand, 1085728 - 1085631
Alignment:
| Q |
145 |
tcattttctagcaatgctctccagttttgcatctcaacaagtgccttagcagaacggtaggagagagcgatccgataattcaaatctccaagccatat |
242 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||| ||| ||||| |||||||||||| ||| || || |||||||| ||||||||||||||||| |
|
|
| T |
1085728 |
tcattctctaacaatgctctccagttttgcatctcaataagcgccttcgcagaacggtagttgagggctattcgataatttaaatctccaagccatat |
1085631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 3 - 64
Target Start/End: Complemental strand, 1085875 - 1085814
Alignment:
| Q |
3 |
atcttcccttcgttccatcccacaaaagcgcggcctcttttttgctctattctcaactgcca |
64 |
Q |
| |
|
||||||||||| |||||||| |||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
1085875 |
atcttcccttctttccatcctgcaaatgcacggcctcgcttttgctctattctcaactgcca |
1085814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University