View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20763_low_19 (Length: 238)
Name: NF20763_low_19
Description: NF20763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20763_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 126 - 221
Target Start/End: Original strand, 23310947 - 23311042
Alignment:
| Q |
126 |
tattgtcttactgggagaacactagagactacgaagccaccctttttaccaccagacatgtcaaactgaagcttctcttctggtggcaaatcaaag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23310947 |
tattgtcttactgggagaacactagagactacgaagccaccctttttaccatcagacatgtcaaactgaagcttctcttctggtggcaaatcaaag |
23311042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 23310822 - 23310871
Alignment:
| Q |
1 |
tttctttacaatatatcaaacgaaaattgaagatttttcagagttcattt |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23310822 |
tttctttacaatatatcaaacgaaaattgaagatttttcagagttcattt |
23310871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 146 - 221
Target Start/End: Original strand, 32092623 - 32092698
Alignment:
| Q |
146 |
actagagactacgaagccaccctttttaccaccagacatgtcaaactgaagcttctcttctggtggcaaatcaaag |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
32092623 |
actagagactatgaagccaccctttttaccaccagacatgtcaaaccggagcttctcttctggcggcaaatcaaag |
32092698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 146 - 221
Target Start/End: Original strand, 32069609 - 32069684
Alignment:
| Q |
146 |
actagagactacgaagccaccctttttaccaccagacatgtcaaactgaagcttctcttctggtggcaaatcaaag |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || | ||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
32069609 |
actagagactatgaagccaccctttttaccaccggagaggtcaaaccgaagcttctcctccggtggcaaatcaaag |
32069684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 34239305 - 34239264
Alignment:
| Q |
1 |
tttctttacaatatatcaaacgaaaattgaagatttttcaga |
42 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
34239305 |
tttctttacagtatatcaaaagaaaattgaagatttttcaga |
34239264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 41527323 - 41527364
Alignment:
| Q |
1 |
tttctttacaatatatcaaacgaaaattgaagatttttcaga |
42 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41527323 |
tttctctacagtatatcaaacgaaaattgaagatttttcaga |
41527364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University