View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20763_low_21 (Length: 237)
Name: NF20763_low_21
Description: NF20763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20763_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 64 - 221
Target Start/End: Original strand, 38993820 - 38993977
Alignment:
| Q |
64 |
gtggcactctttaatttacatcttaatttcttacattaactttatttgaataattgaatgtctaatggatgatattaaacttctcatcaatttactccaa |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38993820 |
gtggcactctttaatttacatcttaatttctaacattaactttatttgaataattgaatgtctaatggatgatattaaacttctcatcaatttactccaa |
38993919 |
T |
 |
| Q |
164 |
tctattttccgaaaatnnnnnnngagcacggctaaataatgcgaaggaatggcataag |
221 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38993920 |
tctattttccgaaaataaaaaaagagcacggctaaataatgcgaaggaatggcataag |
38993977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University