View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20763_low_8 (Length: 381)
Name: NF20763_low_8
Description: NF20763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20763_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 360
Target Start/End: Complemental strand, 12167620 - 12167261
Alignment:
| Q |
1 |
taagagatccatttttacaagaacttgatcatataccttcttcttcttacttcaacatcacaagtactactagtactacttcacctgcttctataattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167620 |
taagagatccatttttacaagaacttgatcatataccttcttcttcttacttcaacatcacaagtactactagtactacttcacctgcttctataattga |
12167521 |
T |
 |
| Q |
101 |
tgttgcttcttctggtgttaatgttactacttcatcatcttcttctgcttctgtttttgcacttgatgagttgagatcaatatcaagaccatgtaaaaac |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167520 |
tgttgcttcttctggtgttagtgttactacttcatcatcttcttctgcttctgtttttgcacttgatgagttgagatcaatatcaagaccatgtaaaaac |
12167421 |
T |
 |
| Q |
201 |
atattctcaaatatgattcagatctctcctaatccaaagttacctaattatgaatcttcttcaacaatagcagcaccttctccaagaccaattaaacctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167420 |
atattctcaaatatgattcagatctctcctaatccaaagttacctaattatgaatcttcttcaacaatagcagcaccttctccaagaccaattaaacctt |
12167321 |
T |
 |
| Q |
301 |
ctgctgttatttcaaccaacatcaatattaatgctaaggattctcttctagacaacacag |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167320 |
ctgctgttatttcaaccaacatcaatattaatgctaaggattctcttctagacaacacag |
12167261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University