View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20764_high_38 (Length: 337)

Name: NF20764_high_38
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20764_high_38
NF20764_high_38
[»] chr2 (1 HSPs)
chr2 (39-246)||(4275689-4275896)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 39 - 246
Target Start/End: Original strand, 4275689 - 4275896
Alignment:
39 attgatgatgcgattctccatccatccactttagtagtacacttttttggtacataggttaagtgtatgattgatagttttatgttaggtttgtcgaaat 138  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
4275689 attggtgatgcgattctccatccatccactttagtagtacacttttttggtacataggttaagtgtatgattgatagttttatgttaggtttgtcaaaat 4275788  T
139 catggcgattttggtagatcatgtatttgtaaaaattatagcatattttaatctacgtttggtttgatttggttttatcgagtcctaatataaaattgtc 238  Q
     ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||    
4275789 tatggcgattttggtagatcgtgtatttgtaaaaattatagcatattttaatctacgtttggtttgatttgattttatcgcgtcctaatataaaattgtc 4275888  T
239 gtgagttt 246  Q
    ||||||||    
4275889 gtgagttt 4275896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University