View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_high_38 (Length: 337)
Name: NF20764_high_38
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 39 - 246
Target Start/End: Original strand, 4275689 - 4275896
Alignment:
| Q |
39 |
attgatgatgcgattctccatccatccactttagtagtacacttttttggtacataggttaagtgtatgattgatagttttatgttaggtttgtcgaaat |
138 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4275689 |
attggtgatgcgattctccatccatccactttagtagtacacttttttggtacataggttaagtgtatgattgatagttttatgttaggtttgtcaaaat |
4275788 |
T |
 |
| Q |
139 |
catggcgattttggtagatcatgtatttgtaaaaattatagcatattttaatctacgtttggtttgatttggttttatcgagtcctaatataaaattgtc |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
4275789 |
tatggcgattttggtagatcgtgtatttgtaaaaattatagcatattttaatctacgtttggtttgatttgattttatcgcgtcctaatataaaattgtc |
4275888 |
T |
 |
| Q |
239 |
gtgagttt |
246 |
Q |
| |
|
|||||||| |
|
|
| T |
4275889 |
gtgagttt |
4275896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University